Overall Format
Page 1 will be your picture of the experiment 4 gel of total RNA labeled with a figure legend. Page 2 will be your RT-PCR gel labeled and with a figure legend.
Page 3 will be Fig. 5 replacement figure labeled.
Page 4 will be the figure legend for Fig. 5
Page 5 will be your replacement results section. One page maximum double spaced 12 point font.
Worth a total of 20 marks (10 % of final mark):
--------- 10 marks for the results section (Page 1) (5%)
----------10 marks for the assignment section (Pages 2-3) (5%)
0.5 marks will be deducted for each spelling and grammatical mistake.
RESULTS SECTION (Page 1-2): 10 marks
Page 1
Your picture should have 4 lanes of total RNA. Below is the marking scheme for 5 marks.
| Mark | Lanes with RNA |
| 0 | 0 |
| 1 | 1 |
| 2 | 2 |
| 3 | 3 |
| 5 | 4 |
Page 2 will be a picture of the gel for which you performed the RT-PCR reactions.
This is the gel that will be marked for the total of 5 marks.
Marking scheme: The number of lanes that have RT-PCR product with the correct band size.
| Mark | Number of lanes that worked properly |
| 0 | 0 |
| 1 | 1 |
| 1.5 | 2 |
| 2 | 3 |
| 2.5 | 4 |
| 3.0 | 5 |
| 3.5 | 6 |
| 4 | 7 |
| 5 | 8 |
ASSIGNMENT SECTION (Pages 3-5): 10 marks
In 1986 Garber and Segall published a paper on a gene specifically expressed during sporulation in yeast, SPS4. In a parallel universe where you live now, Tony Garber and Jackie Segall were killed in a plane crash in 1983. Over 20 years later in this parallel universe, you have isolated SPS4 from yeast. Because you live in modern times, you use modern techniques to address the same questions. You are going to provide an updated Figure 5 confirming that the strains contain the correct deletion of SPS4 and demonsrating that no SPS4 transcript is expressed from the deleted sps4::URA3 allele. In addition you will rewrite the results section where this data is presented.
The original Garber and Segall paper.
Page 6 showing the deletion of Figure 5.
Page 7 showing the deleted text that you are expected to replace.
FIGURE-5
I am giving you panel a. Your job will be to supply panels b and c. You are going to transform two strains of the following genotype.
DKB409-MATalpha ho::LYS2 lys2 ura3 leu2 his4::ADE2 ade2
DKB410-MATa ho::LYS2 lys2 ura3 leu2 ade2
These can be mated in various combinations to produce the following diploids from which DNA is extracted. Below are the genotypes of the five samples that you extracted DNA from.
PANEL B
You use this DNA to confirm the that homologous recombination has disrupted the SPS4 gene.
| Samples | Strain | Genotype |
| 1 | DKB411 | MATalpha/MATa ho::LYS2/ho::LYS2 ura3/ura3 leu2/leu2 his4::ADE2/HIS4 ade2/ade2 |
| 2 | KAS307 | MATalpha/MATa ho::LYS2/ho::LYS2 ura3/ura3 leu2/leu2 his4::ADE2/HIS4 ade2/ade2 sps4::URA3/SPS4 |
| 3 | KAS308 | MATalpha/MATa ho::LYS2/ho::LYS2 ura3/ura3 leu2/leu2 his4::ADE2/HIS4 ade2/ade2 sps4::URA3/sps4::URA3 |
What you need to know. 1) I have given you an annotated sequence of SPS4 showing the location of the MluI and ClaI restriction enzyme sites because you are using the same DNA as used in the paper to create the sps4 gene disruption. In addition, the sequence used to make the primers that you will use in your PCR reactions are indicated as lines above the sequence of SPS4. 2) The length of the DNA carring the URA3 gene inserted between the MluI and ClaI sites is 1,245 bases. 3) Below are the sequences of the primers that you use in a PCR to confirm disruption of SPS4.
| Sequence | |
| Primer 1 | CTCAAGAGGGTTTAGTATCC |
| Primer 2 | ATTGACCACTGGTGCTACGG |
OK now you have all the information to work out what the PCR results should look like.
PANEL C
You extract RNA from the following strains either grown vegatively in rich media or undergoing sporulation. The RNA samples you use in the RT-PCR are shown below.
| Sample | Strain | Genotype | Media |
| 1 | DKB411 | MATalpha/MATa ho::LYS2/ho::LYS2 ura3/ura3 leu2/leu2 his4::ADE2/HIS4 ade2/ade2 | Rich media |
| 2 | KAS307 | MATalpha/MATa ho::LYS2/ho::LYS2 ura3/ura3 leu2/leu2 his4::ADE2/HIS4 ade2/ade2 sps4::URA3/SPS4 | Rich media |
| 3 | KAS308 | MATalpha/MATa ho::LYS2/ho::LYS2 ura3/ura3 leu2/leu2 his4::ADE2/HIS4 ade2/ade2 sps4::URA3/sps4::URA3 | Rich media |
| 4 | DKB411 | MATalpha/MATa ho::LYS2/ho::LYS2 ura3/ura3 leu2/leu2 his4::ADE2/HIS4 ade2/ade2 | 10 hours in sporulation media |
| 5 | KAS307 | MATalpha/MATa ho::LYS2/ho::LYS2 ura3/ura3 leu2/leu2 his4::ADE2/HIS4 ade2/ade2 sps4::URA3/SPS4 | 10 hours in sporulation media |
| 6 | KAS308 | MATalpha/MATa ho::LYS2/ho::LYS2 ura3/ura3 leu2/leu2 his4::ADE2/HIS4 ade2/ade2 sps4::URA3/sps4::URA3 | 10 hours in sporulation media |
You perform RT-PCR reactions on your 6 RNA sample using the primers shown below. The positions of these primers within the SPS4 gene are indicated on the annotated sequence of SPS4.
| Sequence | |
| Primer 3 | TATAATAAAAACTTAGACAAACAGG |
| Primer 4 | TACAAATTGAAATTCTCGCC |
OK now you have all the information to work out what the PCR results should look like for Panel C.
RESULTS SECTION
Using the results in your replacement FIGURE 5 and the sporulation efficiencies given below, rewrite the deleted section of the paper.
| Strain | Genotype | % sporulation (100 asci counted) |
| DKB411 | MATalpha/MATa ho::LYS2/ho::LYS2 ura3/ura3 leu2/leu2 his4::ADE2/HIS4 ade2/ade2 | 87 |
| KAS308 | MATalpha/MATa ho::LYS2/ho::LYS2 ura3/ura3 leu2/leu2 his4::ADE2/HIS4 ade2/ade2 sps4::URA3/sps4::URA3 | 81 |
