Click here to see which primer pair you have been assigned
Schedule
|
Lab 4 -Isolation of mouse DNA -Agarose gel analysis -First round of PCR |
|
Lab 5 -Second round of PCR -Polyacrylamide gel/Gel documentation |
|
Lab 6 -Polyacrylamide gel/Gel documentation |
There are 2 goals for this experiment:
1. To extract genomic DNA from mouse tissues. To analyze all the DNA samples using PCR and polyacrylamide gels and to apply that knowledge towards solving a murder mystery.
2. To have some fun by trying to determine who killed who.
Each of you will be assigned a polymorphic primer pair for analysis (see below). You will be marked on the results that you have generated for that primer pair. This is an individual results mark.
Background
Many thanks goes to Julie Treadwell and Dr. Shiva Singh for supplying the mice and primer sequence.
A Dominic Mus Mystery
Copyright Anthony Percival-Smith 2008
The link to the story
You analyse the DNA samples using 3 autosomal polymorphic marker, and a Y chromosome specific marker.
| Primer pair name | Sequence | Size of PCR fragments |
|
3G5 For 3G5 Rev |
TGTCCCTGCTCAGAGAACAGAT AAACACGATAACACTGGGGG |
145 and 126 |
|
5G4 For 5G4 Rev |
AGTAGGCAGATAAGGGGTTTCC TACAGCATCTAGTGAATGGGGG |
188 and 161 |
|
6G2 For 6G2 Rev |
TTCTTCACCTGCCTTCTTCCAC CCCTTTGCTTACCCAAGTTGCT |
158 and 140 |
|
MusY For MusY Rev |
TCCTTGGGCTCTTCATTATTCTTAAC GAGAACCACGTTGGTTTGAGATG |
102 |
The autosomal polymorphic markers that we are using are simple deletion/insertion markers that were found in different strains of mice. These markers are unlinked; in fact, they are on different chromosomes. If a mouse is heterozygous for the polymorphism, fragments of two sizes will be generated in a PCR reaction using primers that flank the polymorphism. If a mouse is homozygous for the larger PCR product, only one larger band will be generated. Finally, if the mouse is homozygous for the deleted product, one band of shorter length will be generated. See figure below.
An example:
Paulo has two fragments and is therefore heterozygous for the polymorphism. Jeri has one fragment and is therefore homozygous for the deletion allele. The evidence does not point to Jeri if the evidence is an uncontaminated sample.
MusY is the Y-specific primer pair. It will detect the presence of Y-chromosome DNA in a sample.
Carla and Jeri are female mice and lack Y-chromosome DNA. Micki and Paulo are male mice and have Y-chromosome DNA. In evidence 1-3 Y-chromosome DNA is present.
Reference material on polymorphic markers
Modern Genetic Analysis 2nd Edition
page 165-166 on Molecular Markers
page 220-222 description of PCR
page 271-277 will give you information on many other kinds of molecular polymorphisms.