EXPERIMENT 4 (Labs 7, 8 and 9)

Light regulated genes in plants

Protocols for Experiment 4

Assignment 3

Schedule

Goal: To characterize light regulation of genes using RT-PCR to assay the levels of gene expression.

Many thanks go to Dr. Denis Maxwell for advice and seeds for this set of experiments.

There are many people who work on plant molecular biology in the Department of Biology at UWO.

N. Huner studies light regulation and physiology

D. Maxwell designed this lab and studies intracellular signaling.

P. Krishna studies the heat-shock response and plant steroids

S. Kohalmi and V. Grbic study plant flowering

M. Bernards studies the plant cell wall

S. Macfie studies metal tolerance in plants

Background

Plants generally do not move, and are dependent for life on their ability to turn light energy into ATP by fixing carbon. Therefore, it should not be surprising that the mechanisms of light regulation are tightly linked to plant morphology and many other plant processes. Dr. Joanne Chory has been at the center of the investigation of light regulation in the plant Arabidopsis. Her Howard Hughes Medical Investigator Web site gives many insights into why light regulation of gene expression should be studied.

The following articles will help you understand the background behind experiment 3.

A review of signaling in plants.

Review paper

The full paper

This experiment is designed to introduce you to a standard approach used in the genetic dissection of a process. The process here is more than just the study of light dependent gene regulation, but is the study of a response to a signal which in this case is light. This study of the phenotype in two environments goes back to the study of the lactose operon in E. coli. The lactose operon expresses enzymes required for the metabolism of lactose in the presence of the signal lactose (really allolactose). In both light regulation and lactose metabolism, a response gene is OFF when there is no signal and ON when there is a signal. Now we want to know how this response is regulated, which requires knowledge of the components required to regulate the response. Genetic screens are used to identify these components by screening or selecting for mutants that can not respond correctly to the signal. These mutants can generally result in one of two phenotypes: the response gene is expressed both when the signal is present and when it is absent, or the response gene is not expressed when the signal is present and when it is absent. Genetic analyses are applied to determine whether the mutation has resulted in a gain-of-function allele or a loss-of-function allele, and to determine whether the mutation is cis or trans to the regulated gene. As we read the primary scientific literature in this course, I hope that you will see this as a general approach for the genetic analysis of process.

Why are we doing these experiments?

1.) To demonstrate in general the use RT-PCR to assay gene expression. 2) To demonstrate how mutants can be used in the study of a process. 3) Introduce you to the wonderful world of plants.

What do you need to know for the experiment?

The expression of chlorophyll a/b-binding protein (CLAB) (assession number AY091169) and another chlorophyll a/b binding protein (CHAB) (assession number AY081644) will be examined. These are light regulated genes.

The expression of polyubiquitin 10 (GeneID 825880) will also be examined. Polyubiquitin is the control.

Table of primer pairs

Gene primer name	Primer sequence
CLAB FOR	TACCCCGGTGGCAGCTTCGACC
CLAB REV	GAAGCAAAATACAGATAAAACTTGG
CHAB FOR	GATCCGTTGGGTCTCGCCGGG
CHAB REV	TCATGATCTTTTCCCAAATGTCAC
Ubiquitin FOR	TCTCATCTTCGCTGGAAAGC
Ubiquitin REV	CCCCAAAACACAAACCACCA

Can you work out the size of the expected PCR products?

Reference Material

Modern Genetic Analysis

Chapter 13 pages 419-440